International Journal of Molecular Sciences2021Full TextOpen Access

The Non-Erythropoietic EPO Analogue Cibinetide Inhibits Osteoclastogenesis In Vitro and Increases Bone Mineral Density in Mice

Zamzam Awida, Almog Bachar, Hussam Saed et al.

6 citations2021Open Access — see publisher for license terms1 related compound

Research Article — Peer-Reviewed Source

Original research published by Awida et al. in International Journal of Molecular Sciences. Redistributed under Open Access — see publisher for license terms. MedTech Research Group provides these references for informational purposes. We do not conduct original research. All studies are the work of their respective authors and institutions.

Abstract

The two erythropoietin (EPO) receptor forms mediate different cellular responses to erythropoietin. While hematopoiesis is mediated via the homodimeric EPO receptor (EPOR), tissue protection is conferred via a heteromer composed of EPOR and CD131. In the skeletal system, EPO stimulates osteoclast precursors and induces bone loss. However, the underlying molecular mechanisms are still elusive. Here, we evaluated the role of the heteromeric complex in bone metabolism in vivo and in vitro by using Cibinetide (CIB), a non-erythropoietic EPO analogue that exclusively binds the heteromeric receptor. CIB is administered either alone or in combination with EPO. One month of CIB treatment significantly increased the cortical (~5.8%) and trabecular (~5.2%) bone mineral density in C57BL/6J WT female mice. Similarly, administration of CIB for five consecutive days to female mice that concurrently received EPO on days one and four, reduced the number of osteoclast progenitors, defined by flow cytometry as Lin<sup>-</sup>CD11b<sup>-</sup>Ly6C<sup>hi</sup> CD115<sup>+</sup>, by 42.8% compared to treatment with EPO alone. In addition, CIB alone or in combination with EPO inhibited osteoclastogenesis in vitro. Our findings introduce CIB either as a stand-alone treatment, or in combination with EPO, as an appealing candidate for the treatment of the bone loss that accompanies EPO treatment.

Full Text
01

Abstract

The two erythropoietin (EPO) receptor forms mediate different cellular responses to erythropoietin. While hematopoiesis is mediated via the homodimeric EPO receptor (EPOR), tissue protection is conferred via a heteromer composed of EPOR and CD131. In the skeletal system, EPO stimulates osteoclast precursors and induces bone loss. However, the underlying molecular mechanisms are still elusive. Here, we evaluated the role of the heteromeric complex in bone metabolism in vivo and in vitro by using Cibinetide (CIB), a non-erythropoietic EPO analogue that exclusively binds the heteromeric receptor. CIB is administered either alone or in combination with EPO. One month of CIB treatment significantly increased the cortical (~5.8%) and trabecular (~5.2%) bone mineral density in C57BL/6J WT female mice. Similarly, administration of CIB for five consecutive days to female mice that concurrently received EPO on days one and four, reduced the number of osteoclast progenitors, defined by flow cytometry as Lin − CD11b − Ly6C hi CD115 + , by 42.8% compared to treatment with EPO alone. In addition, CIB alone or in combination with EPO inhibited osteoclastogenesis in vitro. Our findings introduce CIB either as a stand-alone treatment, or in combination with EPO, as an appealing candidate for the treatment of the bone loss that accompanies EPO treatment.

02

1. Introduction

Erythropoietin (EPO) is a glycoprotein hormone that is produced mainly by the kidneys and plays a crucial role in regulating erythropoiesis [ 1 ]. The secreted hormone acts by binding to the EPO receptor (EPOR) on erythroid progenitor cells in the bone marrow (BM), and stimulates their proliferation, differentiation, and survival. [ 2 ] Recombinant human EPO (rHuEPO) is administered clinically for the treatment of anemia that is secondary to chronic kidney disease, or for certain hematological malignancies [ 3 , 4 , 5 , 6 ]. In addition to hematopoietic cells, EPOR has also been detected in many other cell types and is associated with cytoprotective effects in these non-hematopoietic tissues [ 7 , 8 , 9 , 10 , 11 , 12 ]. While erythropoiesis is mediated by the canonical EPOR homodimer, the tissue protective effects of EPO are thought to act through the heteromeric innate repair receptor (IRR) [ 13 , 14 ], which is composed of EPOR and the β-common receptor subunit (βcR, CD131). This subunit is also used for signaling by other type 1 cytokine receptors, such as GM-CSF, IL-3, and IL-5 [ 15 , 16 , 17 ]. A number of non-hematopoietic EPO analogs have now been developed that selectively activate the IRR and confer tissue protection without a measurable effect on the EPOR-EPOR homodimer and, consequently, without eliciting erythropoiesis or the potential associated adverse effects [ 18 ]. One promising candidate is Cibinetide (pHBSP; ARA 290) which is an 11-amino acid peptide that is modeled from the three-dimensional structure of helix B of the EPO molecule [ 19 ]. Cibinetide interacts with the IRR and has demonstrated efficacy in a number of animal models of angiogenic potential, autoimmune diseases, neuropathy, and organ transplantation [ 20 , 21 , 22 , 23 , 24 , 25 ]. Bone is a highly dynamic tissue that undergoes continuous remodeling throughout life in a process involving the concerted actions of monocyte-derived osteoclasts that resorb mineralized tissue, and mesenchymal osteoblasts that deposit new bone [ 26 , 27 , 28 ]. The tight regulation of the osteoblastic and osteoclastic lineages is thus crucial for the control of bone turnover [ 29 , 30 , 31 , 32 ]. The discovery that EPO has pleiotropic roles in non-hematopoietic tissues has prompted an investigation of the role of EPO in bone homeostasis [ 33 , 34 ]. This is due to the proximity of the bone and hematopoietic cells in the bone marrow milieu as well as the documented crosstalk between the hematopoietic and skeletal systems [ 35 , 36 ]. In that respect, we, and others, have shown that high EPO levels (both exogenously administered as well as a result of over-expression) lead to a dramatic bone loss in mouse models [ 37 , 38 , 39 , 40 , 41 , 42 ]. In accordance with these results, a growing body of evidence now links high EPO levels to bone loss in humans [ 43 , 44 ]. Monocyte differentiation into osteoclasts is driven by the receptor activator for nuclear factor kappa B (RANK)/RANK ligand (RANKL)/osteoprotegerin (OPG) system, and macrophage colony stimulating factor (M-CSF, CD115) [ 45 ]. In the bone marrow, these preosteoclast macrophages express EPOR and recent studies from our lab indicate that EPO stimulates osteoclastogenesis by acting directly on osteoclast precursors [ 38 ]. However, the underlying molecular mechanism that is responsible for EPO-induced bone loss is still unknown. This study was designed to investigate the role of the EPO-R forms in bone metabolism. For this purpose, we used the non-erythropoietic EPO analog Cibinetide, which acts exclusively on the EPOR/CD131 complex. Here we present data suggesting that Cibinetide treatment in murine models is associated with a bone-preserving effect when injected as a single agent. Moreover, Cibinetide counteracts the stimulatory effect of EPO on preosteoclasts, making it a very promising anti resorptive agent, either when given alone or in combination with EPO.

03

2. Results

2.1. Cibinetide (CIB) Inhibits Osteoclastogenesis In Vitro, in a Dose Dependent Manner, without Cytotoxic Effects As the first step, we examined the effect of Cibinetide on the differentiation of bone marrow derived macrophages (BMDM) into osteoclasts as mediated by M-CSF and RANKL, which are both essential for osteoclast differentiation. TRAP staining was used to evaluate the area that was covered by osteoclasts, with treatment with EPO as the positive control for increased osteoclastogenesis [ 38 ]. Cibinetide suppressed osteoclastogenesis in a dose-dependent manner. At low Cibinetide levels (3 μM), osteoclastogenesis was similar to that which was observed in the control (M - CSF and RANKL only) cultures ( Figure 1 a,b). To exclude the possibility that inhibition of osteoclastogenesis by Cibinetide was due to the reduced viability of the osteoclast precursors, we examined the viability by MTT assay. The results confirmed that Cibinetide has no cytotoxic effects at concentrations that effectively inhibited osteoclast differentiation ( Figure 1 c).

04

2.2. Cibinetide (CIB) Exerts Its Inhibitory Effects in the Early Stages of Osteoclastogenesis

To determine the stage at which Cibinetide inhibits osteoclastogenesis, BMDM that were previously cultured with M-CSF only were also supplemented with RANKL at Day 0, and were treated with Cibinetide (150 μM) at different times between days 0 and 4, as shown in the schematic representation ( Figure 2 a). Inhibition of osteoclastogenesis was most effective when Cibinetide was introduced into the cultures at day 0. Reduction of osteoclastogenesis by Cibinetide was far less pronounced when the compound was added at a later time point. These findings support the notion that the anti-osteoclastogenic effect of Cibinetide is manifested most strongly in the initial stages of osteoclast differentiation ( Figure 2 b,c).

05

2.3. Cibinetide (CIB) Suppresses the Expression of Osteoclast-Related Genes

To further examine the inhibitory effects of Cibinetide on osteoclastogenesis in response to RANKL, we examined the expression of the well-known osteoclast-related genes, Cathepsin K (CTSK), OSCAR, OC-STAMP, DC-STAMP, and NFATC1 [ 46 ]. The results ( Figure 3 ) indicated that Cibinetide significantly inhibited the expression of all these osteoclast marker genes. These results are in accordance with the inhibitory effect of Cibinetide on osteoclastogenesis, as presented in Figure 1 and Figure 2 . Collectively, these results confirm that Cibinetide suppresses osteoclastogenesis in vitro.

06

2.4. Cibinetide (CIB) Overrides the Pro-Osteoclastogenic Effects of LPS and EPO

To determine whether the anti osteoclastogenesis effect of Cibinetide can counter enhanced osteoclastogenesis, such as that which is conferred by EPO or LPS, Cibinetide was added to BMDM together with EPO or LPS as follows: BMDMs were treated with M-CSF and RANKL (50 ng/mL) together with EPO (10 U/mL) and/or Cibinetide (150 μM). On the second day, LPS (10 ng/mL) was introduced to the RANKL+M-CSF or to the RANKL+M-CSF+ Cibinetide cultures. On the fourth day, multinucleated osteoclasts were stained for TRAP. The results demonstrate that Cibinetide inhibits osteoclastogenesis even in the presence of LPS or EPO ( Figure 4 a,b).

07

2.5. Cibinetide (CIB) Increases Tissue Mineral Density (TMD) in Both Cortical and Trabecular Bone

To investigate the effect of Cibinetide on bone density, we injected 12-week-old female C57BL/6J mice with Cibinetide (120 µg/kg × 3/week for 4 weeks). At the end of the fourth week, hemoglobin levels were measured and the femurs were analyzed by µCT. As expected, Cibinetide treatment did not have any effect on hemoglobin levels ( Figure 5 a). However, it did cause a 5.8% increase in the cortical TMD and a 5.2% increase in the trabecular TMD, while the trabecular bone fraction (BV/TV) was unchanged ( Figure 5 b,c). To gain more insight into the effect of Cibinetide on bone, we analyzed the expression level of OPG and RANKL in the whole bones of Cibinetide-treated and untreated mice. In line with the observed increase in TMD, Cibinetide treatment resulted in a significant 52.4% increase in the expression of OPG in the whole bone, with no change in the expression of RANKL ( Figure 5 d).

08

2.6. Cibinetide (CIB) Modulates Alkaline Phosphatase (ALP) and CD115 Expression on CD11b − Bone Marrow Cells

As the next stage, we assessed the effect of Cibinetide on the percentage of preosteoblasts (CD11b − ALP + ) as well as preosteoclasts (CD11b − CD115 + ) in the bone marrow [ 47 ]. The results ( Figure 6 a), indicate that Cibinetide treatment did not affect the percentage of these two cell populations in the bone marrow. Importantly, Cibinetide treatment resulted in a 25.59% increase in ALP expression and a 17.79% decrease in CD115 expression on the surface of the CD11b − bone marrow cells ( Figure 6 b,c). These results further support a Cibinetide-mediated increase in osteoblast mineralizing activity and a decrease in the potential for osteoclast differentiation and are in accordance with our findings that are presented in Figure 5 .

09

2.7. Cibinetide (CIB) Overrides the Pro-Osteoclastogenic Effects of EPO In Vivo

To evaluate the capacity of Cibinetide to counteract the effect of EPO on osteoclasts in vivo, we performed a short-term experiment in which 13-week-old female mice were administered Cibinetide (300 µg/kg) for 5 consecutive days, with 2 injections of 120 U EPO on days 1 and 4. These mice were compared to mice that were receiving either Cibinetide or EPO and also to untreated control mice. Flow cytometry analysis revealed an 81.06% increase in the number of osteoclast progenitors, defined as Lin − CD11b − Ly6C hi CD115 + [ 48 , 49 , 50 , 51 ], in the EPO injected mice. However, this was reduced by 42.8% in the EPO + Cibinetide-injected mice compared to the EPO-injected mice, without any change in the numbers of osteoblast precursors ( Figure 7 a). Moreover, Cibinetide treatment downregulated CD115 expression on the osteoclast precursors both when given alone and in combination with EPO, while EPO had no effect ( Figure 7 b). As the next step, we performed an ex vivo osteoclastogenesis assay where a fixed number of BM cells that were collected from mice in each treatment group were cultured in the presence of M-CSF + RANKL. The number of osteoclasts that were measured in this assay reflects the proportion of osteoclast progenitors in the mice at the end of the treatment. The results indicated that cultures that were derived from the EPO-treated mice exhibited a higher degree of osteoclastogenesis than the control cultures, although the difference did not reach statistical significance. Of note, a single injection of EPO at a higher dose (180 U) resulted in an increase both in the proportion of osteoclast progenitors and in the level of CD115 surface expression, as measured after 48 h ( Supplementary Materials, Figure S1 )). Importantly, the level of osteoclastogenesis in cells from the Cibinetide and EPO + Cibinetide-injected mice was significantly lower than that from either the control or EPO groups ( Figure 7 c). With this short-term treatment, no changes in the bone parameters were detected by µCT in any of the treatment groups ( Supplementary Materials, Figure S2 ).

10

2.8. EPO Maintains Erythropoietic Activity in the Presence of Cibinetide (CIB)

To exclude the possibility that Cibinetide antagonizes the erythropoietic effects of EPO on erythroid cells, we measured hemoglobin levels and spleen weights. In addition, we evaluated the levels of TER119 + erythroid progenitor cells in the spleen and bone marrow by flow cytometry. As expected, the EPO treatment resulted in a significant increase in all these parameters and none of the erythropoietic changes that were mediated by EPO were affected by Cibinetide ( Figure 8 ).

11

3. Discussion

While the beneficial anti-inflammatory effects of Cibinetide, a selective IRR agonist, have been well-documented in multiple systems for over a decade now [ 52 ], there is no record of the effect on the skeletal system, which is one of the most studied targets of EPO. This study is the first to address the in vitro and in vivo effects of Cibinetide on bone metabolism, either alone or in combination with EPO. Our results reveal that Cibinetide can counteract the stimulatory effects of EPO on the monocytic-lineage by decreasing the pool of osteoclast precursors that were defined as Lin − CD11b − Ly6C hi CD115 + in the bone marrow, and by further decreasing the expression of CD115 in this population. The observation that this is achieved without interference with the erythropoietic activity of EPO, reflects the specificity of the effect on osteoclast progenitors in the bone marrow. The finding that Cibinetide acts in the early stages of osteoclast differentiation is evidenced by the downregulation of the key transcription factor NFATC1, as well as suppression of the osteoclast differentiation-related genes CTSK, OSCAR, DC-STAMP, and OC-STAMP. Interestingly, EPO has previously been reported by us [ 38 ] and others [ 53 , 54 ] to have an osteoclast stimulatory effect. These seemingly opposing effects of the two EPOR ligands on preosteoclasts in vitro motivated us to examine the interplay between the two ligands during osteoclastogenesis. Importantly, the results revealed that the inhibitory effect of Cibinetide could negate the stimulatory effect that was induced by EPO. Considering the potent anti-inflammatory activities of Cibinetide in LPS-activated macrophages [ 24 , 55 , 56 ], and the fact that LPS is a potent inducer of inflammation and inflammatory bone loss [ 57 ], our finding that Cibinetide mitigates LPS-induced osteoclastogenesis may have significant clinical applications, for example in inflammation-induced osteolysis (e.g., [ 58 , 59 , 60 ]). It should be noted that the components of the heteromeric EPOR and CD131 complex are usually intracellular in the non-inflammatory state and typically are not expressed by healthy tissues although they are rapidly induced under stress conditions [ 61 ]. The robust in vitro anti-osteoclastogenic effects of Cibinetide (in the presence of RANKL and M-CSF), prompted us to investigate whether Cibinetide can also confer a bone preserving effect in vivo, in healthy mice. The administration of Cibinetide to wild-type female mice resulted in a significant increase in TMD, which is an important contributor to bone mineral density (BMD) in cortical and trabecular bone, while the BV/TV remained unchanged after Cibinetide treatment. TMD is a measure of the mineral content inside the trabecular and cortical bone whereas BV/TV measures the amount of trabecular and cortical bone over the total volume of the region of interest. At the resolution that was employed here (10 µm), TMD will thus reflect the mineral density as well as the microscopic porosity (pores of &lt;10–15 µm) as the measured bone volume will include these small voids that cannot be detected due to the resolution. This microscopic porosity includes osteocyte lacunae [ 62 ]. In our study, the Cibinetide-induced increase in TMD may result from increased mineralization of the bone tissue and/or narrowing of the osteocyte lacunae. BMD combines both TMD and BV/TV. It should be noted that despite the seemingly low increase in TMD (~5%), this is a clinically relevant finding since a 5–10% decline is associated with approximately 50–100% higher fracture rates [ 63 ]. Interestingly, the Cibinetide results are very different from the effect that was observed after exogenous EPO administration in mice, where a massive decrease in trabecular bone fraction is evident albeit with no effect on TMD (data not shown). The increased expression levels of OPG in the bone tissue of Cibinetide treated mice, are a possible mechanism for the reduced osteoclastogenesis, reduced bone resorption and increased TMD. This assumption is further supported by a recent study reporting that EPOR regulates OPG expression in osteo-progenitors and regulates osteoblast function and osteoblast-mediated osteoclastogenesis via the RANKL/OPG axis [ 42 ]. The question of whether EPO acts on osteoblasts via the EPOR/CD131 heterodimer remains to be addressed. Despite the similar proportions of preosteoblasts and preosteoclasts in the bone marrow of Cibinetide-injected mice, we found an increased surface expression of alkaline phosphatase, an early osteogenic marker of bone formation and mineralization on preosteoblasts. In addition, there was a decrease in the expression of CD115, one of the receptors for osteoclastogenic factors which acts as a potent stimulator of RANK expression on preosteoclasts [ 64 ]. In line with these findings, the downregulation, blockade, or depletion of CD115 has been shown to suppress the formation and activity of osteoclasts an

12

4. Materials and Methods

4.1. Materials Alpha-MEM and fetal bovine serum (FBS), were purchased from Rhenium (Modiin, Israel) and culture plates were from Corning (New York, NY, USA). LPS from the E. coli strain 0127:B8 (Sigma) was reconstituted in sterile double distilled water (DDW) as a 1 mg/mL stock solution and kept at −20 °C. Dulbecco’s Phosphate Buffered Saline (DPBS) was purchased from Biological Industries. As a source of M-CSF, we used supernatant from CMG 14-12 cells containing 1.3 μg/mL M-CSF [ 38 , 76 ]. RANKL was purchased from R&amp;D Systems, Minneapolis, MN, USA. The peptide Cibinetide was kindly provided by Araim Pharmaceuticals, Inc. (Ossining, NY, USA). Erythropoietin (EPO) was obtained from GMP-manufactured sterile syringes containing rHuEPO (Epoetin alfa, Eprex ® ) as used for patient care. These were kindly provided by Janssen Cilag, Israel, and were employed throughout this study.

13

4.2. Animals

Female wild-type mice of the inbred strain C57BL/6J-RccHsd, aged 8–13 weeks, were purchased from Envigo (Jerusalem, Israel) and housed at the Tel-Aviv University animal facility. Animal care and all procedures were in accordance with, and with the approval of, the Tel Aviv University Institutional Animal Care and Use Committee (Permit number 01-19-032).

14

4.3. Cell Culture

In vitro osteoclastogenesis: Bone marrow cells were harvested from the femurs and tibias of 8- to 13-week-old female mice. The cells were seeded on tissue-culture treated plates in standard medium (α-MEM supplemented with 10% fetal bovine serum). On the following day, the non-adherent cells were seeded in non–tissue culture-treated plates in standard medium supplemented with 100 ng/mL M-CSF [ 77 ], which induces cell proliferation and differentiation into preosteoclasts. For the osteoclastogenesis assay, preosteoclasts were plated in 96-well plates (8000 cells per well) with standard medium that was supplemented with 20 ng/mL M-CSF and 50 ng/mL RANKL (R&amp;D Systems), which was replaced every 2 days. Treatments in culture (EPO, Cibinetide, LPS) were added together with RANKL, as indicated. On the 4–5th day, the multinucleated osteoclasts [ 78 ] were stained using a tartrate-resistant acid phosphatase (TRAP) [ 79 ] kit (Sigma-Aldrich, St Louis, MO, USA) and the relative TRAP-positive surface was measured using ImageJ software. Ex vivo osteoclastogenesis: The bone marrow cells were harvested from the femurs and tibias of 13-week-old female mice and were then seeded into tissue culture-treated plates in standard medium and allowed to attach overnight. Non-adherent cells were plated into 96 well plates in standard medium that was supplemented with M-CSF (in the form of 2% v/v culture supernatant from CMG 14–12 cells), and 50 ng/mL recombinant murine RANKL. The medium was replaced every other day. After 6–7 days, the cells were stained for tartrate-resistant acid phosphatase (TRAP) and the relative TRAP-positive surface was measured using ImageJ software.

15

4.4. Microcomputed Tomography (microCT)

The femurs (one per mouse) were examined using the µCT50 system (Scanco Medical AG, Wangen-Brüttisellen, Switzerland) [ 80 , 81 ]. Briefly, scans were performed at a 10 µm resolution, 90 kV energy, 114 mA intensity, and 1100 msec integration time. The mineralized tissues were segmented by a global thresholding procedure following Gaussian filtration of the stacked tomographic images [ 82 ]. Trabecular bone parameters were measured in the secondary spongiosa of the distal femoral metaphysis. Cortical parameters were determined in a 1 mm height ring in the mid-diaphyseal region.

16

4.5. Hemoglobin Levels

Hemoglobin (Hgb) levels were measured in venous blood (that was drawn from the facial vein) by means of a “Mission Plus” hemoglobin/hematocrit meter (Acon, San Diego, CA, USA).

17

4.6. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) Assay

Cell viability was determined using an MTT assay, essentially as described previously [ 83 ]. The bone marrow-derived macrophages (BMDM) were seeded into 96-well plates (1× 10 4 cells/well) and then incubated with 100 ng/mL M-CSF in the presence of various concentrations of Cibinetide. After 48 h of incubation, MTT (0.5 mg/mL) was added to each well for 3 h. At the end of the incubation, the insoluble formazan products were dissolved in acidic isopropanol, and absorbance at 560 nm was measured to assess the number of viable cells (proliferation and cytotoxicity).

18

4.7. Flow Cytometry

The bone marrow (BM) cells were flushed from the femurs or tibias, and the red blood cells were lysed using ACK lysis buffer (Quality Biological, Gaithersburg, MD). The cells were then stained for 20 min at 4 °C with conjugated anti-mouse antibodies (see Table 1 for a list of the antibodies that were used). After this time, cells were washed with PBS containing 1% FBS and analyzed by either Gallios or Cytoflex flow cytometers and Kaluza or CytExpert software (all from Beckman Coulter, Indianapolis, Indiana 46268, USA).

19

4.8. Real-Time RT PCR

Total RNA was extracted from BMDM using the TriRNA Pure kit (Cat#TRPD200, Geneaid, New Taipei City, Taiwan) and cDNA was synthesized using the qScript cDNA synthesis kit (Quantabio, MA, USA). “Real-time” quantitative PCR (RQ-PCR) was performed on a StepOnePlus instrument using the SYBR Green reagent (both from Applied Biosystems, CA, USA). The relative gene expression was calculated using the ΔΔCT method following normalization to the expression of HPRT as a housekeeping gene. The primers that were used for PCR were as follows: (F, forward; R, reverse): DC-STAMP , F TCCTCCATGAACAAACAGTTCCAA; DC-STAMP , R AGACGTGGTTTAGGAATGCAGCTC; OC-STAMP , F TTGCTCCTGTCCTACAGTGC; OC-STAMP , R GCCCTCAGTAACACAGCTCA; NFATC1 , F GAGTACACCTTCCAGCACCTT; NFATC1 , R TATGATGTCGGGAAAGAGA; HPRT , F TCCTCCTCAGACCGCTTTT; HPRT , R CCTGGTTCATCATCGCTAATC; OSCAR , F CGTGCTGACTTCACACCAAC; OSCAR , R GGTCACGTTGATCCCAGGAG; Cathepsin K , F GATACTGGACACCCACTGGGA; Cathepsin K , R CATTCTCAGACACAATCCAC; RANKL , F CATTCTCAGACACAATCCAC; RANKL , R ACATCCAACCATGAGCCTTC; OPG , F GAGACACAGCTCACAAGAGCAA; OPG , R GCTTTCACAGAGGTCAATGTCTT.

20

4.9. Statistical Analysis

The values are expressed as mean ± SEM (standard error of the mean). A Student’s t -test was used for calculating the statistical significance when comparing two groups of variables. In experiments with &gt;2 groups of variables, a one-way ANOVA was applied. The level of statistical significance was set at p ≤ 0.05. Asterisks between bars indicate significant differences between two groups (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, and **** p ≤ 0.0001). All statistical analyses were performed using Prism 9 (GraphPad).

Article Details
DOI10.3390/ijms23010055
PubMed ID35008482
PMC IDPMC8744753
JournalInternational Journal of Molecular Sciences
Year2021
AuthorsZamzam Awida, Almog Bachar, Hussam Saed, Anton Gorodov, Nathalie Ben‐Califa, Maria Ibrahim, Albert Kolomansky, Jennifer Ana Iden, Liad Graniewitz Visacovsky, Tamar Liron, Sahar Hiram‐Bab, Michael Brines, Yankel Gabet, Drorit Neumann
LicenseOpen Access — see publisher for license terms
Citations6