Neutrophil Extracellular Traps Contain Calprotectin, a Cytosolic Protein Complex Involved in Host Defense against Candida albicans

Neutrophils are the first line of defense at the site of an infection. They encounter and kill microbes intracellularly upon phagocytosis or extracellularly by degranulation of antimicrobial proteins and the release of Neutrophil Extracellular Traps (NETs). NETs were shown to ensnare and kill microbes. However, their complete protein composition and the antimicrobial mechanism are not well understood. Using a proteomic approach, we identified 24 NET-associated proteins. Quantitative analysis of these proteins and high resolution electron microscopy showed that NETs consist of modified nucleosomes and a stringent selection of other proteins. In contrast to previous results, we found several NET proteins that are cytoplasmic in unstimulated neutrophils. We demonstrated that of those proteins, the antimicrobial heterodimer calprotectin is released in NETs as the major antifungal component. Absence of calprotectin in NETs resulted in complete loss of antifungal activity in vitro . Analysis of three different Candida albicans in vivo infection models indicated that NET formation is a hitherto unrecognized route of calprotectin release. By comparing wild-type and calprotectin-deficient animals we found that calprotectin is crucial for the clearance of infection. Taken together, the present investigations confirmed the antifungal activity of calprotectin in vitro and, moreover, demonstrated that it contributes to effective host defense against C. albicans in vivo . We showed for the first time that a proportion of calprotectin is bound to NETs in vitro and in vivo .

Qualitative analysis of the protein composition of NETs We isolated neutrophils from healthy donors and induced them to form NETs using phorbol myristate acetate (PMA). After gently washing the NETs twice to remove unbound proteins, we solubilized NET-bound proteins with DNase-1 ( Figure S1 ). NET proteins were digested with trypsin and analyzed by nano-scale liquid chromatography coupled matrix-assisted laser desorption/ionization mass spectrometry (nano LC-MALDI-MS). The identification quality is represented by the MS/MS spectrum of S100A9, a subunit of calprotectin found with this approach ( Figure S2 A ). A protein was considered to be associated to NETs when the identification criteria (see Methods ) were fulfilled in at least two from a total of three independent samples. We identified 24 different proteins ( Table 1 , NET Database: http://web.mpiib-berlin.mpg.de/cgi-bin/pdbs/lc/index.cgi ), nine of which were previously shown to localize in NETs by immunofluorescence microscopy [3] , [37] , which correlates well with the results of our approach. 10.1371/journal.ppat.1000639.t001 Table 1 Summary of identified NET proteins. Cellular localization Protein name Gene name Swissprot/TREMBL Granules Leukocyte elastase ELA2 P08246 Lactotransferrin LTF P02788 Azurocidin AZU1 P20160 Cathepsin G CTSG P08311 Myeloperoxidase MPO P05164 Leukocyte proteinase 3 PR3 P24158 Lysozyme C LYZ P61626 Neutrophil defensin 1 and 3 DEFA-1 and -3 P59665 , P59666 Nucleus Histone H2A H2A Q9NV63 + Histone H2B: a) Histone H2B H2B Q16778 + b) Histone H2B-like H2B Q3KP43 , Q6GMR5 Histone H3 H3 Q71DI3 + Histone H4 H4 P62805 + Myeloid cell nuclear differentiation antigen MNDA P41218 Cytoplasm S100 calcium-binding protein A8 S100A8 P05109 S100 calcium binding protein A9 S100A9 P06702 S100 calcium-binding protein A12 S100A12 P80511 Cytoskeleton Actin ( and/or ) ACTB , ACTG1 P60709 , P63261 Myosin-9 MYH-9 P35579 Alpha-actinin (1 and/or -4) ACTN1 , ACTN4 P12814 , O43707 Plastin-2 LCP1 P13796 Cytokeratin-10 KRT-10 P13645 Peroxisomal Catalase CAT P04040 Glycolytic enzymes Alpha-enolase ENO1 P06733 + Transketolase TKT P29401 Proteins that localize to NETs. Proteins are organized by their localization in unstimulated neutrophils. Those identified to be NET-associated for the first time in this report are shown in blue. Swissprot/TREMBL accession numbers marked with a “+” denote possible forms of the protein that cannot be discriminated by this analysis. We identified two distanced groups of histone H2B. The larger group of individual histone H2B types we refer to as H2B and the other type that is less well characterized we refer to as “H2B-like”. All possible accession numbers can be found in the NET Database ( http://web.mpiib-berlin.mpg.de/cgi-bin/pdbs/lc/index.cgi ). We identified proteins that have a nuclear, granular or cytoplasmic localization in unstimulated neutrophils. Among the nuclear components, we confirmed the presence of all four subtypes of core histones and newly found the myeloid cell differentiation antigen (MNDA). We also identified eight granular proteins, five of which (neutrophil elastase (NE), lactotransferrin (LTF), cathepsin G (CG), myeloperoxidase (MPO) [3] and more recently proteinase 3 (PR3) [37] ) were previously found associated with NETs. Azurocidin, lysozyme C (LysC) and α-defensins were not known to be NET components. Notably, we found eleven cytoplasmic proteins; two glycolytic enzymes, catalase, five cytoskeletal proteins and three S100 proteins. We confirmed NET association of twelve proteins found in this study by indirect immunofluorescence. Notably, the linker histone H1, bactericidal/permeability increasing protein (BPI), pentraxin 3 (PTX-3) and cathelicidin (CAP-18), were described as NET-associated [3] , [38] , [39] , but we did not find them with this approach. Immunoblot analysis, however, confirmed the presence of BPI, but not of PTX-3 or CAP-18 ( Figure S2 B–D ). To evaluate the specificity of our approach, we analyzed all purification steps. As previously described, activated neutrophils release many unbound proteins into the supernatant [40] ( Figure 1A and B , lane 2) which were removed by two washes with culture medium ( Figure 1A and B , lane 3 and 4). NET-associated proteins were specifically released by Dnase-1 ( Figure 1A and B ) with or without protease inhibitor cocktail (lane 7 and 8 respectively). As an additional control for the specificity of our approach we demonstrated that two cytoplasmic proteins, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH), were present in the supernatant ( Figure 1B , lane 2), but not in the nuclease-digested NETs ( Figure 1B , lanes 7 and 8). 10.1371/journal.ppat.1000639.g001 Figure 1 Identification of NET-associated proteins. (A) Silver stained SDS-PAGE and (B) immunoblots with samples from NET protein purification procedure. Human neutrophils were stimulated to form NETs. Supernatants from unstimulated (lane 1) and stimula

The association of calprotectin to NETs suggests that the complex is released during a specific form of holocrine secretion [42] referred to as NETosis [43] . Using indirect immunofluorescence we verified that calprotectin is released through NET formation in vitro ( Figure 3A–F ). A calprotectin-heteroduplex-specific antibody [44] confirmed that the dimer was cytoplasmic (red), and it overlapped with granular MPO (green) in the compact cytoplasm of unstimulated cells ( Figure 3A ). There was also a faint calprotectin signal within the nucleus (DNA stain, blue) consistent with the fact that cytoplasmic proteins with a mass below 30 kDa can diffuse through the nuclear pore complex. Thirty minutes after stimulation the neutrophils flattened as a sign of activation revealing a granular staining for MPO and a more dispersed cytoplasmic staining for calprotectin ( Figure 3B ). After stimulation for 1 hour, we observed partial colocalization of MPO and calprotectin in the cytoplasm ( Figure 3C ). This increased two hours after activation, when the chromatin decondensed and the nuclear membrane disassembled. At this time point calprotectin, MPO and DNA colocalized ( Figure 3D ). A proportion of the MPO signal remained in the area between the plasma membrane and the decondensed nucleus. Three and 4 hours post-activation, when the plasma membrane ruptured, calprotectin, DNA and MPO colocalized on NETs ( Figure 3E–F ). 10.1371/journal.ppat.1000639.g003 Figure 3 Neutrophils release calprotectin by forming NETs. (A–F) Confocal images of human neutrophils without stimulation (A), after 0.5 h (B), 1 h (C), 2 h (D), 3 h (E) and 4 h (F) after activation. Samples were stained with antibodies specific for the calprotectin heteroduplex (red) and for MPO (green). DNA was stained with DRAQ5 (blue). Calprotectin localizes to the cytoplasm and partially to the nucleus (A, arrow). After stimulation for 0.5 h (B) the neutrophils flattened and formed numerous vacuoles. This reveals a granular staining for MPO and a more dispersed cytoplasmic staining for calprotectin. After stimulation for 1 h (C) the neutrophils round up slightly. The MPO and calprotectin stain partially overlap in the cytoplasm. After stimulation for 2 h (D), calprotectin, MPO and nuclear DNA start to colocalize in the decondensed nucleus (purple). After 3 h (E) and more so after 4 h (F) of stimulation, the cell membrane ruptures and calprotectin is released in NETs colocalizing with MPO and DNA. Scale bar = 10 µm; one experiment out of two is shown. (G–I) Subunits of calprotectin S100A8 and S100A9 are released after cell death during NET formation and not by degranulation. NET formation was induced with PMA and degranulation using formyl-met-leu-phe (f-MLP). (G) Neutrophil death was monitored by quantification of LDH activity in supernatants calculated as means±s.d. (n = 3). (H) Release of S100A8, S100A9, lactotransferrin (LTF) and myeloperoxidase (MPO) were analyzed by immunoblotting. one experiment out of two is shown. (I) Quantification of immunoblots using 2D densitometry analyzing S100A9 protein preparations from supernatants (lane 1), MNase-digested NETs (lane 2) and cell remnants indigestible for MNase (lane 3). Values were calculated as means±s.d. (n = 3) from one experiment out of two. To determine whether calprotectin is released during NET cell death or before the plasma membrane ruptures, we compared neutrophils that were treated either with PMA to stimulate NET formation [3] or with the microbial peptide formyl-met-leu-phe (f-MLP) to stimulate degranulation [40] . At the indicated time points we monitored neutrophil cell death by quantifying extracellular LDH ( Figure 3G ) and solubilized NET-bound proteins by adding Dnase-1 ( Figure 3H ). We subsequently collected the supernatants containing both unbound and NET-bound proteins to determine the total release of the indicated proteins during degranulation and NET formation. We analyzed the samples by immunoblotting and probed for the calprotectin subunits S100A8 and S100A9 as well as for two granular proteins, MPO and LTF ( Figure 3H ). Thirty minutes after f-MLP treatment, neutrophils released MPO and LTF, but not S100A8 nor S100A9. Four hours after f-MLP treatment, minor amounts of S100A8 and S100A9 appear in the supernatants and less than 10% of the cells were dead. During NET formation, MPO and LTF were secreted in low amounts before S100A8 and S100A9 were released confirming that neutrophils also degranulate upon PMA-activation [40] . Significant amounts of extracellular calprotectin were only found 3 to 4 hours after stimulation, when 40 and 70% of the neutrophils respectively were dead. Furthermore, we determined how much of the total calprotectin amount present in the neutrophil actually binds to NETs. After stimulation we quantified S100A9 released into the supernatant, bound to NETs and remaining in the cell remnants by quantitative immunoblots. Approximately 30% of the total S100A9 was boun

We addressed the role of calprotectin in C. albicans infections comparing wild-type to S100A9 knockout mice. These animals transcribe the mRNA for S100A8 but are deficient in S100A8 and S100A9 protein [47] . C. albicans exploits different host niches and we investigated three of them: (i) subcutaneous inoculation, which leads to confined abscesses; (ii) intranasal infection, which causes pulmonary candidiasis and (iii) intravenous challenge, which mimics disseminated systemic candidiasis. The dimensions of the abscess lesions were measured at indicated time points. On average, the area of the lesions in calprotectin –deficient mice were twice as large (200 mm 2 ) as compared to those of wild-type animals (100 mm 2 ) measured at two, four and six days after inoculation ( Figure 5A–E ). At day four, 60% of the abscesses in calprotectin-deficient mice ulcerated as indicated by extensive necrosis which also included the epidermis ( Figure 5A ). Consistent with a less severe progression, abscesses of wild-type animals were restricted to subcutaneous areas without involvement of outer skin layers ( Figure 5D ). Eight days after inoculation, the size of the abscesses in calprotectin-deficient and wild-type mice was similar, indicating that calprotectin is essential for the initial phase of the disease but that eventually other mechanisms clear the infection. Interestingly, in about 30% of the infected knockout mice, but not in wild-type controls, infection spread from the original abscess to surrounding areas of the skin ( Figure S6 ). In our experimental settings neutrophil recruitment ( Figure S5 G ) and NET formation ( Figure S5 A–F ) was similar in knockout and wild-type animals. 10.1371/journal.ppat.1000639.g005 Figure 5 Calprotectin is required for antifungal immunity. (A–D) Subcutaneous abscesses induced with C. albicans of representative calprotectin -deficient (a and b) and wild-type (c and d) mice at days 2, 4, 6 and 8 post infection (p.i.). (E) the area of the abscess lesions of calprotectin-deficient animals compared to wild type was monitored over 8 days p.i. (n = 10); abscesses of calprotectin-deficient animals are significantly larger at days 2 (P = 0.0007), 4 (P = 0.0012), 6 (P = 0.0003) but not at day 8. (F) calprotectin-deficient mice are more susceptible to intranasal challenge with C. albicans than wild-type mice (n = 10, P = 0.0001). (G) Fungal load in the lungs after intranasal challenge with C. albicans is significantly higher in calprotectin-deficient compared to wild-type mice (n = 11; P = 0.048). (H) Calprotectin-deficient mice are more susceptible to intravenous challenge with C. albicans than wild-type mice (n = 10, P = 0.0159). In pulmonary candidiasis, wild-type mice show disease symptoms within three days but recover and survive. In contrast, calprotectin-deficient mice carried a significantly higher fungal load than wild-type controls ( Figure 5F ) and succumbed to C. albicans ( Figure 5G ). Intravenous challenge is lethal in both calprotectin-deficient and wild-type mice. However, the knockout animals died significantly earlier ( Figure 5H ), suggesting that also in deep-seeded infection sites, the antimicrobial activity of calprotectin contributes to containment of fungal growth. This is consistent with a previous report that calprotectin reduces bacterial load in systemic staphylococcal infection [31] . We conclude that calprotectin is required for an effective acute antifungal response.

The analysis presented here identified 24 NET-associated proteins. Nine of the 24 proteins were described previously as NET-associated which correlates well to our approach. Fifteen proteins were hitherto unknown to be NET-bound and their association to NETs was confirmed by immunoblotting and indirect immunofluorescence (NET Database). The data underscore the specificity and reproducibility of the analysis. Moreover, the composition of the identified NET proteins was very similar among different neutrophil donors (NET Database). The small number of identified NET proteins is surprising since the neutrophil cell membrane ruptures during the process of NET release. Additionally, we used mild washing conditions for the isolation. Therefore, the protein incorporation into NETs appears to be selective. We found that, in addition to five nuclear proteins, the NETs contain eight cationic granule proteins. Furthermore, we identified eleven cytoplasmic proteins which have neutral to acidic isoelectric points. This suggests that charge is not an exclusive requirement for binding to NETs. In previous reports histone H1 [3] , bactericidal/permeability increasing protein (BPI) [3] , cathelicidin (CAP-18) [37] , [39] and pentraxin 3 (PTX-3) [38] have been described as NET-associated proteins. In contrast, we did not find these proteins in our MS approach. We further investigated these proteins by immunoblot ( Figure S2B–C ). We did not obtain clear results for histone H1 because commercially available anti H1-antibodies are cross-reactive with other histones (data not shown). This remains to be clarified. We could, however, detect the 25 kDa cleavage product of BPI in both neutrophil lysates and NET extracts. The failure of MS analysis to detect BPI remains unclear ( Figure S1B ). Notably, we detected CAP-18 and PTX-3 in neutrophil lysates but not in NET extracts. Therefore the presence of these two proteins in NETs should be further investigated. It is possible that these proteins are very loosely attached to NETs, that they are present in very low amounts, that they were lost during the isolation procedure or that the MS analysis failed to detect them. Notably, neither by immunoblotting nor by MS did we find GAPDH, a very abundant cytoplasmic and highly cationic protein. This supports the assumption that NET binding is not exclusively mediated by charge. Quantification by immunoblots showed that 15 NET proteins comprised 90% of the total protein amount in NETs, indicating good coverage. Detection of 1.25 ng of catalase per µg NET-DNA underscored the sensitivity of the approach. As the amounts of NET proteins were similar in different donors the approach was also reproducible (NET Database). More importantly this suggests that NETs do not assemble randomly and are similar in many individuals. The core histones are the major protein components in NETs as shown by the quantitative analysis. However, we found a reduction of the molecular mass of NET-associated compared to chromatin histones, possibly caused by post-translational modifications. Indeed, histone H3 is deiminated during NET formation in HL60 cells but this remains to be confirmed in primary neutrophils [48] . Additionally, the stoichiometry of the four histones is different in NETs when compared to chromatin. There is less H3 and less H4 in NETs than in chromatin, but the significance of these differences remain unclear. High resolution FESEM correlated with this finding. We determined a transverse periodicity in individual NET-fibers that was similar to the actual dimensions of intact and partially degraded nucleosomes. The role of some of the identified cytoplasmic proteins in NETs is unknown but there are indications for potential functions. Enolase, for example, has been found to be a plasminogen activator on leukocyte surfaces, although the secretion mechanism is unknown [49] . NET-association could explain how enolase is released allowing it to participate in tissue remodeling at inflammatory sites. We identified S100A8 and S100A9 that form the heterodimer calprotectin as NET-associated proteins by MS analysis and by indirect immunofluorescence. The dimer lacks a secretion signal and localizes to the cytoplasm as well as partially to the nucleus of unstimulated neutrophils. Therefore, the proteins must be released in order to function as an antimicrobial protein against extracellular pathogens. The release of calprotectin by neutrophils [50] and other cells [36] in response to specific stimuli was previously reported. Our data, however, establish NET formation as a hitherto unrecognized mechanism of calprotectin release in neutrophils. Interestingly, incubation of C. albicans with neutrophils was reported to increase extracellular calprotectin and, simultaneously decrease neutrophil viability [51] . The release mechanism, however, remained unknown. Consistent with these data we reported that C. albicans induces neutrophils to form NETs and die in the pr

Human neutrophils were seeded in 12-well tissue culture plates to a density of 1.7×10 6 ml −1 (RPMI 1640 without phenol red). 1.7×10 6 –3.4×10 6 (according to 1–2 wells) and 1.7×10 7 (according to 10 wells) neutrophils were used for analytical and MS identification respectively. Neutrophils were activated with 20 nM PMA for 4 h at 37°C in a 5% CO 2 atmosphere. Each well was carefully washed twice after removing the supernatant by pipetting 1 ml of fresh and pre-warmed RPMI into the well along the wall of the well. Each wash was incubated for 10 min at 37°C. Subsequently the NETs were digested for 20 min in 1 ml RPMI with 10 U/ml DNase-1 (Worthington). DNase-1 was stopped with 5 mM EDTA (final concentration). The samples were centrifuged at 300×g to remove whole cells and then at 16,000×g to remove debris. Proteins were acetone precipitated. Four matched samples from different wells were pooled together and transferred to a 30 ml glass corex tube and 16 ml of ice-cold acetone (−20°C) was added. For precipitation samples were incubated overnight at −20°C and then centrifuged at 10 000×g for 30 min at 4°C. The protein pellet was washed with 1 ml 80% acetone buffered in 20 mM Tris-HCl pH 8.0 and solubilized in 120 µl SDS loading buffer or prepared for MS identification as described below. For verification of our purification procedure we followed each step of the isolation procedure by analysis of the respective sample using silver stained SDS electrophoresis and immunoblotting. We harvested all steps including the supernatant after 4 h incubation, the washes 1 and 2, and the NET digests. As controls (i) NETs were mock-digested with nuclease-free RPMI and (ii) unstimulated neutrophils that did not release NETs were washed twice and incubated with RPMI containing 10 U/ml Dnase-1 for 20 min at 37°C. Each sample was derived from one well containing 1.7×10 6 neutrophils in a volume of 1 ml. Four samples out of 4 wells were pooled, acetone precipitated, solubilized in 120 µl SDS loading buffer and boiled for 3 min. To account for potential protein loss due to proteolytic activity in the samples a complete purification procedure was performed in the presence of protease inhibitor cocktail (Sigma P1860; 1∶200) added to the wells 2 h after stimulation start as described above. Protease inhibitor cocktail was additionally present in all media used for washing and digestion. For analysis of the purification steps we loaded 30 µl of each pooled sample (equaling 1 well and 1.7×10 6 neutrophils) on SDS protein gels (Tris-HCl 10–20%). The gels were either silver stained as described elsewhere [63] or immunoblotted by transferring to a PVDF membrane (Immobilon 40; Millipore). The immunoblots were performed as described in detail for the quantitative blots below. The following primary antibodies were used: α-elastase (Calbiochem 481001, 2 µg/ml), α-azurocidin (Sigma N5662, 0.5 µg/ml), α-histone H2B (Upstate 07-371, 1 µg/ml), α-S100A8 combined with α-S100A9 (Acris BM4029 and BM4027, both at 2.5 µg/ml), α-catalase (Sigma C0979, 1 µg/ml), α-GAPDH (Labfrontier LF-PA0018, 0.5 µg/ml), α-LDH (Abcam ab7639, 1 µg/ml). As secondary antibodies horseradish-peroxidase-conjugated F(ab')2 fragments (Jackson ImmunoResearch) were used in 1∶20 000 dilutions. For MS analysis NET proteins from 3 different donors were purified independently in the absence (donor 1–3, named sample 1–3) or presence of the protease inhibitor cocktail indicated above (donor 1–2, named sample 4 and 5). DNA-concentration, neutrophil elastase activity and reactive oxygen species (ROS) were measured as described previously [6] .

The samples were analyzed by bottom-up nano-LC/MALDI-MS as described in detail in the NET Database. Proteins were digested with trypsin and the resulting peptides separated by nano-LC (Dionex). Peptides were fractionated (Probot microfraction collector, Dionex) and analyzed with a 4700 Proteomics Analyzer (Applied Biosystems) MALDI-TOF/TOF instrument. The criterion for the identification of a protein was a minimum number of 3 peptides fulfilling the Mascot homology criteria. Candidates with two peptides fulfilling these criteria were verified by checking the fragmentation rules, such as hypercleavage sites (Asp, Glu, Pro), the appearance of common immonium masses and mass losses [64] . A protein was considered as localizing to NETs only when found in at least 2 independent samples from different donors. Exceptions are MNDA, actinin and lysozyme C. MNDA and actinin were identified with one peptide in independent samples only, however the peptide is unique to both proteins within the IPI-database. Presence of lysozyme C in NETs was verified by immunoblotting. The MS analysis is described in more detail on the NET database and in the supporting materials.

Recombinant human S100A8 and S100A9 for quantification were purified as previously described [66] . cDNA of human S100A8 and S100A9 in the plasmid pQE32 (C. Kerkhoff) were amplified by standard PCR using primers with HindIII and NdeI restriction sites at either end ( S100A8 : AGTCCTAAGCTTCTACTCTTTGTGGCTTTCTT , ATTACACATATGATGTTGACCGAGCTGGA ; S100A9 : ATCTAACATATGATGACTTGCAAAATGTCGCAGC , ATCTTCAAGCTTTTAGGGGGTGCCCTCCC ). The PCR products were cloned into the expression vector pET28a+ (Invitrogen) and confirmed by sequencing. We purchased recombinant core histones from Upstate, catalase purified from human erythrocytes (Sigma-Aldrich) and all other proteins purified from human neutrophils (Athens Research and Technology).

1.7×10 6 ml −1 human neutrophils were seeded in 1 ml RPMI medium containing 10 U/ml DNase-1 in 12 well tissue culture plates. For each condition to be tested three wells were seeded with neutrophils (n = 3). They were stimulated to form NETs using 20 nM PMA, or to degranulate using 5 µM f-MLP at 37°C in a 5% CO 2 atmosphere similar to [40] . Dnase-1 was present to collect all released proteins, also the ones that are bound to NETs. At the indicated time points the supernatants were collected. Hundred µl aliquots were used to quantify LDH activity in the samples using the Cytotoxicity Assay™ (Promega) as a marker for cell death [67] , [68] . As 100% control for LDH we lysed the same amount of neutrophils in 1 ml RPMI with 0.1% Triton X-100 and measured 100 µl. The rest of the samples were acetone precipitated. Precipitates were boiled in 30 µl SDS sample buffer and analyzed by immunoblotting using anti-S100A8 (Acris BM4029, 2.5 µg/ml), anti-S100A9 (Acris BM4027, 2.5 µg/ml), anti-LTF (Sigma-Aldrich L3262, 2 µg/ml) and anti-MPO (DAKO A0398, 2 µg/ml) antibodies. To determine the relative amounts of calprotectin in the supernatant after NET formation and in NETs we seeded 1.7×10 6 neutrophils per well and induced them to make NETs for 4 hours. We collected the supernatant and washed the cells twice. The washes were discarded. Then we digested the NETs with nuclease in the same volume and removed the supernatant again after 20 min. Subsequently, we added 200 µl reducing SDS protein sample buffer to the remaining debris in the wells and scratched them thoroughly and boiled for 3 minutes. As 100% control we lysed the same amount of neutrophils in 400 µl protein sample buffer and boiled as well. The supernatant and the NET digest were lyophilized overnight and also resuspended in 200 µl sample buffer. 40 µl of each fraction was loaded and subjected to SDS PAGE and immunoblotting with an anti-S100A9 antibody. The signal intensities of the bands were analyzed by 2D densitometry as described under “Quantification of NET proteins”. The relative amounts were calculated.

Twenty times 5×10 5 human neutrophils were seeded into 24 well tissue culture plates each in 500 µl RPMI and stimulated with 20 nM PMA for 4h at 37°C in a 5% CO 2 atmosphere to form NETs. Supernatants were removed, NETs were washed twice with 1 ml RPMI and digested with 500 µl 10 U/ml DNase-1 each. The digested NET proteins were pooled into two 5 ml fractions and concentrated 10-fold on filter columns with a 3.5 kDa cut-off to a volume of 500 µl. The concentrated samples were incubated for 2 h either with a combination of anti-S100A8 and anti-S100A9 (Acris BM4029 and BM4027, 10 µg each), or isotype mouse IgG1 as a control (Sigma M5284), immobilized on 100 µl magnetic sepharose beads (Pierce). After incubation, the samples were diluted back to the original volume using fresh medium to complement metal ions. CFU were determined after incubation of these samples overnight with C. albicans . Viability of C. albicans was also monitored using the XTT assay as stated in supporting material Figure S4 . The immunodepletion was evaluated by immunoblotting. Samples were tested for the presence of calprotectin (Acris BM4027, 2.5 µg/ml) and lactotransferrin (Sigma-Aldrich L3262, 2 µg/ml) as a control.

For analysis of abscess formation 10 anesthetized animals per group were shaved on the back and subcutaneously infected with 5×10 7 C. albicans . Abscesses were measured with a caliper at the indicated time points. Pulmonary candidiasis was induced by intranasal challenge of anesthetized animals with 5×10 7 C. albicans and systemic candidiasis by intravenous injection to the tail vein with 5×10 5 C. albicans in 10 animals per group. Inoculation doses were determined by CFU counts after plating. For intranasal and intravenous challenge, survival was monitored daily. For fungal load, lungs from 11 mice per group were macerated and CFU determined 3 days after intranasal challenge. For histology of pulmonary infections lungs were removed 24 h after intranasal challenge and 6 days after subcutaneous challenge abscesses were removed. Tissue samples were fixed in 2% formalin, dehydrated, embedded in paraffin, sliced to 5 µm, rehydrated and stained with hematoxylin and eosin (H & E). For immunostainings, samples were rehydrated, subjected to antigen retrieval and incubated with primary antibodies directed against calprotectin subunits S100A8 and S100A9 (produced in house), MPO (DAKO A0398) and histone (Santa Cruz 8030). These were detected with secondary antibodies coupled to Cy2, Cy3 or Cy5. DNA was detected with DRAQ5™ (Biostatus). For fine structural analysis of paraffin-embedded tissue samples, 5 µm sections were rehydrated, postfixed with glutaraldehyde, contrasted using repeated changes of 0.5% OsO 4 and 0.05% tannic acid, dehydrated in a graded ethanol series, critical-point dried and coated with 5 nm platinum/carbon. For immunostainings with human neutrophils, 1×10 5 cells were seeded on 13 mm glass cover slips, stimulated with 20 nM PMA and fixed in 2% formalin at the indicated time points. Specimens were blocked with 3% cold water fish gelatin, 5% donkey serum, 1% BSA, 0.25% TWEEN 20 in PBS, incubated with primary antibodies directed against S100A8/A9 complex (Acris BM4025) and MPO (DAKO A0398) and then washed. Primary antibodies were detected with species-specific secondary antibodies and DNA with DRAQ5™. Specimens were analyzed using a SP5 confocal microscope (Leica).

Figure S1 Optimization of NET protein purification. Human neutrophils were induced to make NETs. (A) The optimal time point for isolation of NET proteins was determined by monitoring DNA amount and neutrophil elastase (NE) activity at the indicated time points. Four hours after stimulation, both DNA amount and NE activity reached a maximum. This time point was chosen for purification and identification of NET proteins. (B–C) Different nucleases were compared. DNase-1 (B) and MNase (C), a non-processive nuclease, digest NETs to release a maximum of 2.5 µg/ml DNA. Thus we used 10 U/ml Dnase-1 for protein identifications. For a stable DNA concentration in all quantitative analyses we used 5 U/ml MNase and normalized protein concentration to DNA concentration. NETs were digested for different amounts of time. Both Dnase-1 (D) and MNase (E) released a maximum of DNA before 10 min of digest. To ensure complete degradation of NETs 20 min were used for all experiments. The concentration (F) of Dnase-1, as well as the time of digest (G), was confirmed in a silver-stained SDS-PAGE analysis to be optimal at 10 U/ml and 20 min for a maximal protein yield. Shown are means±s.d. (n = 3) of representative experiments from two. (4.40 MB TIF) Click here for additional data file. Figure S2 Mass spectrometry (MS) identification quality and immunoassays to verify the absence or presence of proteins in NETs. (A) Representative identification of NET protein S100A9 by LC-MS/MS. We obtained 51% sequence coverage from 8 MS/MS spectra and a Mascot ion score of 102. We show a representative MS/MS spectrum of one peptide mass (1806.9532). In this case, identification was confirmed by 9 y-ions in series and 11 b-ions, and the immonium ion of His (H). We evaluated the NET association of (B) bactericidal/permeability increasing protein (BPI), (C) pentraxin 3 (PTX-3) and (D) cathelicidin CAP-18 that have been described as NET-associated [3] , [4] , [37] , [38] , but were not found in our MS approach. BPI and CAP-18 are endogenously cleaved by neutrophil proteinases into a 25 kDa and a 5 kDa (LL-37) cleavage product [2] . We immunoblotted neutrophil (PMN) lysates, NET extracts and purified proteins as positive controls. Human neutrophil granular extract (hNGE) was used as positive control for the presence of BPI, as well as recombinant human PTX-3 and purified human LL-37 peptide. We confirmed NET association of BPI, but not of PTX-3 and CAP-18. (E) Quantification of calprotectin. We confirmed that calprotectin was a bona fide NET protein by washing the NETs until unbound calprotectin was not detectable using an enzyme-linked immunosorbent assay (ELISA) from Hycult. The data are the average of two independent experiments (means±s.d., n = 4), bdl = below detection limit (1.6 ng/ml). (0.42 MB TIF) Click here for additional data file. Figure S3 NET Protein quantification. Representative quantitative immunoblots for S100A8 (A) and MPO (E) showing six different protein amounts of the standard protein as well as a NET sample in triplicate. The signal intensities (B and F) were plotted against the amount of standard protein within a linear range (C for S100A8 and G for MPO). The resulting equation was used to calculate the respective amounts of proteins as means from three different samples (D and H). The protein amounts (D and H) are specified as mg or µmoles referred to the amount of DNA within the sample. The DNA amount is the mean of all samples used for this quantification. One sample equals the amount of NETs isolated from 1.7×10 6 human neutrophils. Similar analyses of all the quantified proteins are available on the NET database. (0.98 MB TIF) Click here for additional data file. Figure S4 Antifungal activity and composition of NETs is similar under different conditions (MOI or temperature) and stimuli (PMA or C. albicans ). Human neutrophils were induced to make NETs and washed twice. C. albicans and NETs were incubated overnight in all assays either at 30°C to preserve yeast-form growth or at 37°C to induce hyphal growth. (A) Cryptococcus neoformans or C. albicans were added to NETs with a MOI of 0.04, incubated overnight at 37°C and CFU determined, for C.n.+/−NETs P<0.01, for C.a.+/−NETs P<0.05. (B) C. albicans was added to NETs and incubated to induce hyphal growth. NETs inhibit C. albicans hyphae at a MOI of 0.04 and 0.01 similarly. (C) C. albicans was added to NETs and incubated to preserve yeast-form growth. NETs inhibit C. albicans yeast at a MOI of 0.2, 0.04 and 0.01 similarly. (D) Addition of MNase to NETs significantly reduced inhibition of C. albicans yeast, P<0.01. (A–D) Shown are means±s.d. (n = 3) from one representative experiment out of three. (E) Representative tissue culture plate and (F) light microscopic image with growing C. albicans hyphae in the absence (top) or presence of NETs (bottom). (G–I) Antifungal NET assays using XTT [46] we confirmed that NETs also reduce C. albicans growth under hyphae inducing c